Sample identity
- Trajectory ID
- RDB000966__4V50_1_B-C
- Source structure
- 4V50_1_AW
- Length
- 23 nt
- Canonical chain set
- B-C
- Partition
- train
MD-derived metadata
2.33 Å
Median heavy-atom RMSD to frame 0, without an additional fit.
- Mean radius of gyration
- 12.32 Å · heavy atoms
- Frames
- 1,001 · 0–100 ns
- Coordinate status
- pass
These are MD statistics, not RNADynNet predictions. Calculation details
Structure & trajectory preview
Interactive trajectory preview, per-residue RMSF and NMC: Coming soon.
The original experimental source structure and the matching MD initial structure are different artifacts. Use the release GRO/PDB with its XTC; do not substitute the source PDB.
Sequence & chain mapping
Sequence order: B → C
UCGGGCUCAUAACCCGAAUGUUU
| Canonical chain | PDB chain | label_asym_id | auth_asym_id |
|---|---|---|---|
| B | B | B | AW |
| C | C | C | AX |
Residue-level mapping and atom ranges will accompany the trajectory package.
Quality information
Current warnings: None recorded in this field.
A coordinate check pass does not establish equilibrium or convergence. Diagnostic flags are retained; they are not automatic exclusion labels.
Files & integrity
v1.0
| File | Contents | Availability |
|---|---|---|
| rna.xtc | RNA-only coordinates · 1,001 frames | Available on Box |
| rna.gro | Matching initial coordinates / topology | Available on Box |
| rna.pdb | Matching initial structure with PDB chain mapping | Available on Box |
rna.xtc · SHA-256
b2d4c27141555a2505fcd23656ea48af5349fc4d2e375f70bfd57c1690e7b63f
rna.gro · SHA-256
2c086bbb1cb48a67337e9123ac0b60ff430d695abb82b18d33ceff327d930ff3
rna.pdb · SHA-256
a4848873d75f2c762bcd47c74afdfeb763b8dcbc1c35d3477bf7c952d15d86ff