Sample identity
- Trajectory ID
- RDB001904__7BV2_1_D-E
- Source structure
- 7BV2_1_T-P
- Length
- 25 nt
- Canonical chains
- D, E
- Partition
- train
MD-derived metadata
3.44 Å
Median heavy-atom RMSD to frame 0, without an additional fit.
- Mean radius of gyration
- 13.07 Å · heavy atoms
- Frames
- 1,001 · 0–100 ns
- Coordinate status
- pass
These are MD statistics, not RNADynNet predictions. Calculation details
Structure & trajectory preview
Interactive trajectory preview, per-residue RMSF and NMC: Coming soon.
The original experimental source structure and the matching MD initial structure are different artifacts. Use the release GRO/PDB with its XTC; do not substitute the source PDB.
Sequence & chain mapping
GAUUAAGUUAUUUUAUAACUUAAUC
| Canonical chain | PDB chain | label_asym_id | auth_asym_id |
|---|---|---|---|
| D | D | D | P |
| E | E | E | T |
Residue-level mapping and atom ranges will accompany the trajectory package.
Quality information
Current warnings: None recorded in this field.
A coordinate check pass does not establish equilibrium or convergence. Diagnostic flags are retained; they are not automatic exclusion labels.
Files & integrity
RNADynBench-v0.1-20261001
| File | Contents | Availability |
|---|---|---|
| rna.xtc | RNA-only coordinates · 1,001 frames | Coming soon |
| rna.gro | Matching initial coordinates / topology | Coming soon |
| rna.pdb | Matching initial structure with PDB chain mapping | Coming soon |
rna.xtc · SHA-256
87d70a78e3b14a9516db3e83e3cc9556fc6f4c01333afe669cd2f2ac4583982e
rna.gro · SHA-256
8bd02900b237683e15ce0d67705e66b5516e2e8a29f5ba85a280f1092403c5c6
rna.pdb · SHA-256
9cd7bcd18cd5e3102385fcb43cec3257bcdd9c5d1ef8830d3287ef1651f4eca7