7Z4H · A

rna_02355__7Z4H_1_A

Coming soon

Source PDB ↗

Sample identity

Trajectory ID: rna_02355__7Z4H_1_A
RNA-Solo ID: rna_02355
Split identity: rna_02355
Source structure: 7Z4H_1_A
Length: 92 nt
Canonical chains: A
Partition: train

MD-derived metadata

21.60 Å

Median heavy-atom RMSD to frame 0, without an additional fit.

Mean radius of gyration: 34.24 Å · heavy atoms
Frames: 1,001 · 0–100 ns
Coordinate status: pass

These are MD statistics, not RNADynNet predictions. Calculation details

Structure & trajectory preview

Interactive trajectory preview, per-residue RMSF and NMC: Coming soon.

The original experimental source structure and the matching MD initial structure are different artifacts. Use the release GRO/PDB with its XTC; do not substitute the source PDB.

Sequence & chain mapping

UAAAGAUGAGACGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU

Canonical chain	PDB chain	label_asym_id	auth_asym_id
A	A	A	A

Residue-level mapping and atom ranges will accompany the trajectory package.

Quality information

Current warnings: geometry:rmsd_high

Inherited warnings: geometry:rmsd_high

A coordinate check pass does not establish equilibrium or convergence. Diagnostic flags are retained; they are not automatic exclusion labels.

Historical aliases

No alternate ID recorded.

Files & integrity

RNADynBench-v0.1-revision-20260920-x0

File	Contents	Availability
rna.xtc	RNA-only coordinates · 1,001 frames	Coming soon
rna.gro	Matching initial coordinates / topology	Coming soon
rna.pdb	Matching initial structure with PDB chain mapping	Coming soon

rna.xtc · SHA-256

e388b5a8dd65a63909caf3d58631e290daca5120edc3904696dc6015822a34ea

rna.gro · SHA-256

9d50c7cd2c7d1acc50b4e036af01a68f2943a425e1743e64dc90dc92cf09beb9

rna.pdb · SHA-256

49cb77389f9f9b6da6530a7322f5ce937c5666a815ed4ff195d0017c33f4dfe5